Stem-loop sequence eca-mir-451

AccessionMI0012785 (change log)
DescriptionEquus caballus miR-451 stem-loop
Gene family MIPF0000148; mir-451
Literature search

1 open access papers mention eca-mir-451
(1 sentences)

Stem-loop
   c     a   u    ga                 u 
5'  uuggg aug cgag  aaccguuaccauuacug g
    ||||| ||| ||||  |||||||||||||||||  
3'  gaccc ugu guuc  uuggcaaugguaaugau u
   a     a   c    uc                 u 
Get sequence
Deep sequencing
3049 reads, 200 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr11: 42750408-42750479 [-]
sense
ENSECAT00000012832 ; FLOT2-201; intron 10
Clustered miRNAs
< 10kb from eca-mir-451
eca-mir-144chr11: 42750581-42750646 [-]
eca-mir-451chr11: 42750408-42750479 [-]
Database links

Mature sequence eca-miR-451

Accession MIMAT0013041
Sequence

17 - 

aaaccguuaccauuacuguguu

 - 38

Get sequence
Deep sequencing3049 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).