Stem-loop sequence eca-mir-423

AccessionMI0012784 (change log)
DescriptionEquus caballus miR-423 stem-loop
Gene family MIPF0000329; mir-423
Literature search

2 open access papers mention eca-mir-423
(4 sentences)

Stem-loop
   ag          -ag   g    a     cua 
5'   gcugaggggc   aga cgag cuuuu   u
     ||||||||||   ||| |||| |||||   u
3'   ugacuccccg   ucu gcuc gaaaa   u
   --          gag   g    -     ccu 
Get sequence
Deep sequencing
6425 reads, 300 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr11: 43782441-43782503 [+]
sense
ENSECAT00000017975 ; NSRP1-201; intron 1
ENSECAT00000027366 ; eca-mir-423-201; exon 1
Database links

Mature sequence eca-miR-423-5p

Accession MIMAT0013039
Sequence

5 - 

ugaggggcagagagcgagacuuu

 - 27

Get sequence
Deep sequencing2606 reads, 1 experiments
Evidence not experimental

Mature sequence eca-miR-423-3p

Accession MIMAT0013040
Sequence

41 - 

agcucggucugaggccccucagu

 - 63

Get sequence
Deep sequencing3819 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).