Stem-loop sequence eca-mir-21

AccessionMI0012776 (change log)
DescriptionEquus caballus miR-21 stem-loop
Gene family MIPF0000060; mir-21
Literature search

6 open access papers mention eca-mir-21
(22 sentences)

Stem-loop
   u     gu        a     a     a    u a 
5'  gucgg  agcuuauc gacug uguug cugu g a
    |||||  |||||||| ||||| ||||| |||| | u
3'  caguc  ucggguag cugac acaac ggua c c
   a     ug        -     g     -    - u 
Get sequence
Deep sequencing
74461 reads, 5.2e+03 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr11: 33863745-33863816 [+]
sense
ENSECAT00000027586 ; eca-mir-21-201; exon 1
Database links

Mature sequence eca-miR-21

Accession MIMAT0013029
Sequence

8 - 

uagcuuaucagacugauguuga

 - 29

Get sequence
Deep sequencing74019 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).