Stem-loop sequence eca-mir-195

AccessionMI0012774 (change log)
DescriptionEquus caballus miR-195 stem-loop
Gene family MIPF0000006; mir-15
Literature search

1 open access papers mention eca-mir-195
(6 sentences)

Stem-loop
   acaccca  uc     g  cu          -a         --   ggg 
5'        gc  cccug cu  agcagcacag  aauauuggc  acu   a
          ||  ||||| ||  ||||||||||  |||||||||  |||    
3'        ug  gggac ga  ucgucguguc  uuauaaccg  uga   a
   -----ag  gu     g  cc          gg         uc   gag 
Get sequence
Deep sequencing
5928 reads, 350 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr11: 50048869-50048962 [-]
intergenic
Clustered miRNAs
< 10kb from eca-mir-195
eca-mir-497chr11: 50049193-50049251 [-]
eca-mir-195chr11: 50048869-50048962 [-]
Database links

Mature sequence eca-miR-195

Accession MIMAT0013027
Sequence

21 - 

uagcagcacagaaauauuggc

 - 41

Get sequence
Deep sequencing5688 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).