Stem-loop sequence eca-mir-144

AccessionMI0012772 (change log)
DescriptionEquus caballus miR-144 stem-loop
Gene family MIPF0000093; mir-144
Literature search

1 open access papers mention eca-mir-144
(2 sentences)

Stem-loop
         g        a         -a    gc 
5' ggcugg auaucauc uauacugua  guuu  g
   |||||| |||||||| |||||||||  ||||   
3' cugauc uguaguag auaugacau  caga  a
         a        -         ca    gu 
Get sequence
Deep sequencing
83 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr11: 42750581-42750646 [-]
sense
ENSECAT00000012832 ; FLOT2-201; intron 10
Clustered miRNAs
< 10kb from eca-mir-144
eca-mir-144chr11: 42750581-42750646 [-]
eca-mir-451chr11: 42750408-42750479 [-]
Database links

Mature sequence eca-miR-144

Accession MIMAT0013024
Sequence

43 - 

uacaguauagaugauguacu

 - 62

Get sequence
Deep sequencing48 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).