Stem-loop sequence eca-mir-371

AccessionMI0012764 (change log)
DescriptionEquus caballus miR-371 stem-loop
Gene family MIPF0000068; mir-290
Stem-loop
   --       cu    g          g     
5'   acucaaa  gugg ggcacuuucu ugcu 
     |||||||  |||| |||||||||| ||| a
3'   ugaguuu  uacc ccgugaaggg augc 
   ug       uu    g          -     
Get sequence
Deep sequencing
6 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr10: 22831962-22832021 [+]
intergenic
Clustered miRNAs
< 10kb from eca-mir-371
eca-mir-371chr10: 22831962-22832021 [+]
eca-mir-372chr10: 22832128-22832268 [+]
Database links

Mature sequence eca-miR-371-5p

Accession MIMAT0013013
Sequence

1 - 

acucaaacugugggggcacu

 - 20

Get sequence
Deep sequencing5 reads, 1 experiments
Evidence not experimental

Mature sequence eca-miR-371-3p

Accession MIMAT0013014
Sequence

38 - 

aagugccgccauuuuuugagugu

 - 60

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).