Stem-loop sequence eca-mir-30d

AccessionMI0012758 (change log)
DescriptionEquus caballus miR-30d stem-loop
Gene family MIPF0000005; mir-30
Literature search

4 open access papers mention eca-mir-30d
(7 sentences)

Stem-loop
   u  g  u         ccc           gug  ac 
5'  gu gu guaaacauc   gacuggaagcu   ag  a
    || || |||||||||   |||||||||||   ||   
3'  ca cg cguuuguag   cugacuuucga   uc  u
   -  g  u         --a           --a  gg 
Get sequence
Deep sequencing
41763 reads, 2.8e+03 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr9: 75212697-75212767 [-]
intergenic
Clustered miRNAs
< 10kb from eca-mir-30d
eca-mir-30dchr9: 75212697-75212767 [-]
eca-mir-30bchr9: 75208370-75208427 [-]
Database links

Mature sequence eca-miR-30d

Accession MIMAT0013006
Sequence

7 - 

uguaaacauccccgacuggaag

 - 28

Get sequence
Deep sequencing41359 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).