Stem-loop sequence eca-mir-30b

AccessionMI0012757 (change log)
DescriptionEquus caballus miR-30b stem-loop
Gene family MIPF0000005; mir-30
Literature search

3 open access papers mention eca-mir-30b
(8 sentences)

Stem-loop
   u          u  -a        -ua u 
5'  guaaacaucc ac  cucagcug   c a
    |||||||||| ||  ||||||||   | c
3'  cauuuguagg ug  gggucggu   g a
   u          -  ga        uag u 
Get sequence
Deep sequencing
2179 reads, 150 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr9: 75208370-75208427 [-]
intergenic
Clustered miRNAs
< 10kb from eca-mir-30b
eca-mir-30dchr9: 75212697-75212767 [-]
eca-mir-30bchr9: 75208370-75208427 [-]
Database links

Mature sequence eca-miR-30b

Accession MIMAT0013005
Sequence

1 - 

uguaaacauccuacacucagcu

 - 22

Get sequence
Deep sequencing2179 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).