Stem-loop sequence eca-mir-133a

AccessionMI0012749 (change log)
DescriptionEquus caballus miR-133a stem-loop
Gene family MIPF0000029; mir-133
Literature search

5 open access papers mention eca-mir-133a
(12 sentences)

Stem-loop
       g       aa  u  a        gccuc 
5' gcua agcuggu  aa gg accaaauc     u
   |||| |||||||  || || ||||||||      
3' cgau ucgacca  uu cc ugguuuag     u
       g       ac  c  c        guaac 
Get sequence
Deep sequencing
1590 reads, 100 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr8: 39915603-39915670 [+]
sense
ENSECAT00000028024 ; eca-mir-133a-201; exon 1
antisense
ENSECAT00000025536 ; MIB1-201; intron 11
Clustered miRNAs
< 10kb from eca-mir-133a
eca-mir-1-1chr8: 39912211-39912288 [+]
eca-mir-133achr8: 39915603-39915670 [+]
Database links

Mature sequence eca-miR-133a

Accession MIMAT0012997
Sequence

43 - 

uuugguccccuucaaccagcug

 - 64

Get sequence
Deep sequencing3172 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).