Stem-loop sequence eca-mir-122

AccessionMI0012747 (change log)
DescriptionEquus caballus miR-122 stem-loop
Gene family MIPF0000095; mir-122
Literature search

8 open access papers mention eca-mir-122
(122 sentences)

Stem-loop
         gg       c           --u  c 
5' agcugu  aguguga aaugguguuug   gu c
   ||||||  ||||||| |||||||||||   ||  
3' ucgaua  ucacacu uuaccgcaaac   ca a
         aa       a           uau  a 
Get sequence
Deep sequencing
11 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr8: 75662539-75662604 [+]
sense
ENSECAT00000027310 ; eca-mir-122-201; exon 1
Database links

Mature sequence eca-miR-122

Accession MIMAT0012995
Sequence

6 - 

uggagugugacaaugguguuug

 - 27

Get sequence
Deep sequencing11 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).