Stem-loop sequence eca-mir-1-1

AccessionMI0012746 (change log)
Previous IDseca-mir-1
DescriptionEquus caballus miR-1 stem-loop
Gene family MIPF0000038; mir-1
Literature search

5 open access papers mention eca-mir-1-1
(14 sentences)

Stem-loop
   u   c                     ac     ugaaca 
5'  acu agaguacauacuucuuuaugu  ccaua      u
    ||| |||||||||||||||||||||  |||||       
3'  ugg uuuuauguaugaagaaaugua  gguau      a
   -   u                     -a     cguaac 
Get sequence
Deep sequencing
103 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr8: 39912211-39912288 [+]
sense
ENSECAT00000028420 ; eca-mir-1-1-201; exon 1
antisense
ENSECAT00000025536 ; MIB1-201; intron 11
Clustered miRNAs
< 10kb from eca-mir-1-1
eca-mir-1-1chr8: 39912211-39912288 [+]
eca-mir-133achr8: 39915603-39915670 [+]
Database links

Mature sequence eca-miR-1

Accession MIMAT0012994
Sequence

50 - 

uggaauguaaagaaguauguau

 - 71

Get sequence
Deep sequencing206 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).