Stem-loop sequence eca-mir-708

AccessionMI0012745 (change log)
DescriptionEquus caballus miR-708 stem-loop
Gene family MIPF0000397; mir-708
Literature search

1 open access papers mention eca-mir-708
(1 sentences)

Stem-loop
      aa        a           a     c  g gg  aa  a 
5' ggu  cugcccuc aggagcuuaca ucuag ug g  ua  ug c
   |||  |||||||| ||||||||||| ||||| || |  ||  || u
3' ccg  gacgggag ucuucgagugu agauc ac c  gu  ac u
      gg        a           c     a  g aa  ac  g 
Get sequence
Deep sequencing
198 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr7: 65231355-65231447 [+]
intergenic
Database links

Mature sequence eca-miR-708

Accession MIMAT0012993
Sequence

14 - 

aaggagcuuacaaucuagcuggg

 - 36

Get sequence
Deep sequencing73 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).