Stem-loop sequence eca-mir-7-2

AccessionMI0012744 (change log)
DescriptionEquus caballus miR-7-2 stem-loop
Gene family MIPF0000022; mir-7
Literature search

1 open access papers mention eca-mir-7-2
(4 sentences)

Stem-loop
         g       u     a  a       u      u  ac 
5' ggucua ugcugug ggaag cu gugauuu guuguu ug  g
   |||||| ||||||| ||||| || ||||||| |||||| ||   
3' ucggau gcgacac ccuuc gg cacuaaa caacag au  u
         -       u     -  -       -      u  ca 
Get sequence
Deep sequencing
42 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr7: 2932716-2932799 [+]
intergenic
Database links

Mature sequence eca-miR-7

Accession MIMAT0012905
Sequence

15 - 

uggaagacuagugauuuuguugu

 - 37

Get sequence
Deep sequencing126 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).