Stem-loop sequence eca-mir-492-2

AccessionMI0012743 (change log)
DescriptionEquus caballus miR-492-2 stem-loop
Gene family MIPF0000499; mir-492
Stem-loop
   aggag           gau        ccacc 
5'      cugcgggacaa   ucuugggg     a
        |||||||||||   ||||||||     u
3'      gacgucuuguu   agaaccuc     u
   --cua           ---        aagag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr7: 54764367-54764428 [+]
sense
ENSECAT00000005962 ; eca-mir-492-2-201; exon 1
ENSECAT00000027381 ; eca-mir-492-1-201; exon 1
Database links

Mature sequence eca-miR-492

Accession MIMAT0012920
Sequence

1 - 

aggagcugcgggacaagauucuu

 - 23

Get sequence
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).