Stem-loop sequence eca-mir-34b

AccessionMI0012741 (change log)
DescriptionEquus caballus miR-34b stem-loop
Gene family MIPF0000039; mir-34
Literature search

1 open access papers mention eca-mir-34b
(2 sentences)

Stem-loop
        cg    -gua       uaa    c        cu u 
5' gugcu  guuu    ggcagug   uuag ugauugua  c g
   |||||  ||||    |||||||   |||| ||||||||  |  
3' cacgg  caaa    ccgucac   aauc acuaacau  g g
        aa    acua       cuc    -        uc a 
Get sequence
Deep sequencing
24007 reads, 1.7e+03 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr7: 20101138-20101221 [+]
intergenic
Clustered miRNAs
< 10kb from eca-mir-34b
eca-mir-34bchr7: 20101138-20101221 [+]
eca-mir-34cchr7: 20101717-20101793 [+]
Database links

Mature sequence eca-miR-34b-5p

Accession MIMAT0012990
Sequence

14 - 

aggcaguguaauuagcugauugu

 - 36

Get sequence
Deep sequencing23388 reads, 1 experiments
Evidence not experimental

Mature sequence eca-miR-34b-3p

Accession MIMAT0012991
Sequence

51 - 

aaucacuaacuccacugccauc

 - 72

Get sequence
Deep sequencing619 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).