Stem-loop sequence eca-mir-24-1

AccessionMI0012738 (change log)
Previous IDseca-mir-24
DescriptionEquus caballus miR-24 stem-loop
Gene family MIPF0000041; mir-24
Literature search

3 open access papers mention eca-mir-24-1
(4 sentences)

Stem-loop
       c  g   a         aaca     g  u 
5' cucc gu ccu cugagcuga    caguu gu u
   |||| || ||| |||||||||    ||||| ||  
3' gagg ca gga gacuugacu    gucag cg g
       a  a   c         --cg     a  u 
Get sequence
Deep sequencing
3240 reads, 150 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr7: 44930163-44930230 [+]
antisense
ENSECAT00000009158 ; IER2-201; intron 5
Clustered miRNAs
< 10kb from eca-mir-24-1
eca-mir-23achr7: 44929817-44929889 [+]
eca-mir-27achr7: 44930014-44930090 [+]
eca-mir-24-1chr7: 44930163-44930230 [+]
eca-mir-8992chr7: 44932141-44932243 [+]
Database links

Mature sequence eca-miR-24

Accession MIMAT0012987
Sequence

44 - 

uggcucaguucagcaggaacag

 - 65

Get sequence
Deep sequencing6192 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).