Stem-loop sequence eca-mir-100

AccessionMI0012732 (change log)
DescriptionEquus caballus miR-100 stem-loop
Gene family MIPF0000033; mir-10
Literature search

1 open access papers mention eca-mir-100
(2 sentences)

Stem-loop
   a   cg    uc   a      g  au 
5'  acc  uaga  cga cuugug ug  a
    |||  ||||  ||| |||||| ||   
3'  ugg  aucu  guu gaacac ac  g
   a   au    gu   c      -  cu 
Get sequence
Deep sequencing
40703 reads, 2.75e+03 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr7: 29549390-29549444 [-]
intergenic
Clustered miRNAs
< 10kb from eca-mir-100
eca-mir-100chr7: 29549390-29549444 [-]
eca-let-7achr7: 29543908-29543979 [-]
Database links

Mature sequence eca-miR-100

Accession MIMAT0012980
Sequence

1 - 

aacccguagauccgaacuugug

 - 22

Get sequence
Deep sequencing40703 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).