Stem-loop sequence eca-mir-615

AccessionMI0012729 (change log)
DescriptionEquus caballus miR-615 stem-loop
Gene family MIPF0000342; mir-615
Literature search

1 open access papers mention eca-mir-615
(1 sentences)

Stem-loop
   ac  --        c          uc     u        cu    g ug 
5'   gc  gggagggg gggagggggg  cccgg gcucggau  cgag g  c
     ||  |||||||| ||||||||||  ||||| ||||||||  |||| |  u
3'   cg  uccucccc cccucucccu  ggguc cgagccug  gcuu u  u
   --  ac        -          cu     -        --    g ua 
Get sequence
Deep sequencing
104 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr6: 70898503-70898599 [+]
sense
ENSECAT00000004024 ; HOXC5-201; intron 1
Database links

Mature sequence eca-miR-615-5p

Accession MIMAT0012976
Sequence

19 - 

ggggguccccggugcucggauc

 - 40

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence not experimental

Mature sequence eca-miR-615-3p

Accession MIMAT0012977
Sequence

62 - 

uccgagccugggucucccucuc

 - 83

Get sequence
Deep sequencing103 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).