Stem-loop sequence eca-mir-26a

AccessionMI0012728 (change log)
DescriptionEquus caballus miR-26a stem-loop
Gene family MIPF0000043; mir-26
Literature search

5 open access papers mention eca-mir-26a
(15 sentences)

Stem-loop
         gg ug  uu         c          guuucc 
5' ggcugu  c  ga  caaguaauc aggauaggcu      a
   ||||||  |  ||  ||||||||| ||||||||||       
3' ucgacg  g  cu  guucauuag ucuuauccgg      u
         ga gu  uu         u          aguguc 
Get sequence
Deep sequencing
181201 reads, 1.31e+04 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr6: 75354670-75354753 [-]
sense
ENSECAT00000020049 ; CTDSP2-201; intron 4
Database links

Mature sequence eca-miR-26a

Accession MIMAT0012975
Sequence

14 - 

uucaaguaauccaggauaggcu

 - 35

Get sequence
Deep sequencing362274 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).