Stem-loop sequence eca-mir-200c

AccessionMI0012727 (change log)
DescriptionEquus caballus miR-200c stem-loop
Gene family MIPF0000019; mir-8
Literature search

4 open access papers mention eca-mir-200c
(11 sentences)

Stem-loop
   -     -      a        u   u   gg 
5'  ccguc uuaccc gcaguguu ggg gcu  u
    ||||| |||||| |||||||| ||| |||  u
3'  gguag aauggg cgucauaa cuc uga  g
   a     u      c        u   -   gg 
Get sequence
Deep sequencing
2 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr6: 34423081-34423144 [+]
sense
ENSECAT00000027401 ; eca-mir-200c-201; exon 1
Clustered miRNAs
< 10kb from eca-mir-200c
eca-mir-200cchr6: 34423081-34423144 [+]
eca-mir-141chr6: 34423490-34423561 [+]
Database links

Mature sequence eca-miR-200c

Accession MIMAT0012974
Sequence

42 - 

uaauacugccggguaaugaugga

 - 64

Get sequence
Deep sequencing2 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).