Stem-loop sequence eca-mir-148b

AccessionMI0012724 (change log)
DescriptionEquus caballus miR-148b stem-loop
Gene family MIPF0000056; mir-148
Literature search

1 open access papers mention eca-mir-148b
(4 sentences)

Stem-loop
      a       ug         u  a    ca    gugg u 
5' agc uuugagg  aaguucugu au cacu  ggcu    c c
   ||| |||||||  ||||||||| || ||||  ||||    | u
3' ucg aagcucu  uucaagaca ua guga  cuga    g c
      a       gu         c  c    --    --aa u 
Get sequence
Deep sequencing
4931 reads, 300 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr6: 71148022-71148104 [+]
sense
ENSECAT00000026506 ; COPZ1-201; intron 1
ENSECAT00000027763 ; eca-mir-148b-201; exon 1
Database links

Mature sequence eca-miR-148b-5p

Accession MIMAT0012971
Sequence

13 - 

gaaguucuguuauacacucagg

 - 34

Get sequence
Deep sequencing163 reads, 1 experiments
Evidence not experimental

Mature sequence eca-miR-148b-3p

Accession MIMAT0012972
Sequence

52 - 

ucagugcaucacagaacuuugu

 - 73

Get sequence
Deep sequencing4767 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).