Stem-loop sequence eca-mir-148b

Accession MI0012724
Description Equus caballus miR-148b stem-loop
Gene family MIPF0000056; mir-148
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-148/mir-152_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology, miR-148 is a microRNA whose expression has been demonstrated in human (MI0000253), mouse (MI0000550), rat (MI0000616) and zebrafish (MI0002015). miR-148 has also been predicted in chicken (MI0001189). These predicted hairpin precursor sequence are related to those of miR-152, which has been expressed in mouse (MI0000174) and is predicted in human (MI0000462). The hairpin precursors (represented here) are predicted based on base pairing and cross-species conservation; their extents are not known. In this case, the mature sequence is excised from the 3' arm of the hairpin.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   a       ug         u  a    ca    gugg u 
agc uuugagg  aaguucugu au cacu  ggcu    c c
||| |||||||  ||||||||| || ||||  ||||    | u
ucg aagcucu  uucaagaca ua guga  cuga    g c
   a       gu         c  c    --    --aa u 
Get sequence
Genome context
Coordinates (EquCab2) Overlapping transcripts
6: 71148022-71148104 [+]
sense
ENSECAT00000026506 ; LOC100064590; intron 1
Database links

Mature sequence eca-miR-148b-5p

Accession MIMAT0012971
Sequence

13 - 

gaaguucuguuauacacucagg

 - 34

Get sequence
Evidence not experimental

Mature sequence eca-miR-148b-3p

Accession MIMAT0012972
Sequence

52 - 

ucagugcaucacagaacuuugu

 - 73

Get sequence
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).