Stem-loop sequence eca-mir-9a

AccessionMI0012720 (change log)
DescriptionEquus caballus miR-9a stem-loop
Gene family MIPF0000014; mir-9
Literature search

2 open access papers mention eca-mir-9a
(4 sentences)

Stem-loop
   uug   g   uc               g      u  ug 
5'    guu uua  uuugguuaucuagcu uaugag gg  u
      ||| |||  ||||||||||||||| |||||| ||  g
3'    uaa aau  aagccaauagaucga auacuu cu  g
   -aa   a   ga               a      -  ga 
Get sequence
Deep sequencing
164 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr5: 41824838-41824916 [+]
sense
ENSECAT00000027820 ; eca-mir-9a-201; exon 1
antisense
ENSECAT00000028824 ; HCN3-202; intron 15
Database links

Mature sequence eca-miR-9a

Accession MIMAT0012967
Sequence

11 - 

ucuuugguuaucuagcuguauga

 - 33

Get sequence
Deep sequencing322 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).