Stem-loop sequence eca-mir-488

AccessionMI0012718 (change log)
DescriptionEquus caballus miR-488 stem-loop
Gene family MIPF0000318; mir-488
Stem-loop
       a  a   cu  c   u      a  c        g u 
5' gaga uc ucu  cc aga aauggc cu ucaaacaa u u
   |||| || |||  || ||| |||||| || |||||||| | c
3' cucu ag aga  gg ucu uuaucg ga aguuuguu a c
       c  a   cu  u   -      -  a        g a 
Get sequence
Deep sequencing
81 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr5: 12172407-12172489 [-]
sense
ENSECAT00000008170 ; ASTN1-201; intron 5
Database links

Mature sequence eca-miR-488

Accession MIMAT0012965
Sequence

52 - 

uugaaaggcuauuucuugguc

 - 72

Get sequence
Deep sequencing69 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).