Stem-loop sequence eca-mir-29c-2

AccessionMI0012717 (change log)
DescriptionEquus caballus miR-29c-2 stem-loop
Gene family MIPF0000009; mir-29
Literature search

2 open access papers mention eca-mir-29c-2
(3 sentences)

Stem-loop
   a        acaggc           ucc       ---     u 
5'  ucucuuac      ugaccgauuuc   ugguguu   cagag c
    ||||||||      |||||||||||   |||||||   ||||| u
3'  gggggaug      auuggcuaaag   accacga   guuuu g
   a        --cagu           uuu       ucu     u 
Get sequence
Deep sequencing
3774 reads, 150 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr5: 30369007-30369094 [+]
intergenic
Database links

Mature sequence eca-miR-29c

Accession MIMAT0012964
Sequence

54 - 

uagcaccauuugaaaucgguua

 - 75

Get sequence
Deep sequencing7401 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).