Stem-loop sequence eca-mir-29c

AccessionMI0012716 (change log)
DescriptionEquus caballus miR-29c stem-loop
Gene family MIPF0000009; mir-29
Literature search

2 open access papers mention eca-mir-29c
(3 sentences)

Stem-loop
   a         -  ggc           ucc       ---     u 
5'  ucucuuaca ca   ugaccgauuuc   ugguguu   cagag c
    ||||||||| ||   |||||||||||   |||||||   ||||| u
3'  gggggaugu gu   auuggcuaaag   accacga   guuuu g
   a         a  ---           uuu       ucu     u 
Get sequence
Deep sequencing
3775 reads, 150 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr5: 30271715-30271802 [+]
intergenic
Clustered miRNAs
< 10kb from eca-mir-29c
eca-mir-29b-2chr5: 30271159-30271239 [+]
eca-mir-29cchr5: 30271715-30271802 [+]
Database links

Mature sequence eca-miR-29c

Accession MIMAT0012964
Sequence

54 - 

uagcaccauuugaaaucgguua

 - 75

Get sequence
Deep sequencing7401 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).