Stem-loop sequence eca-mir-29b-2

AccessionMI0012715 (change log)
DescriptionEquus caballus miR-29b-2 stem-loop
Gene family MIPF0000009; mir-29
Literature search

2 open access papers mention eca-mir-29b-2
(3 sentences)

Stem-loop
            -          c      g  u    uuuucc 
5' cuucuggaa gcugguuuca auggug cu agau      a
   ||||||||| |||||||||| |||||| || ||||       
3' gaggauuuu ugacuaaagu uaccac ga ucua      u
            g          u      -  -    uguuuc 
Get sequence
Deep sequencing
833 reads, 50 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr5: 30271159-30271239 [+]
intergenic
Clustered miRNAs
< 10kb from eca-mir-29b-2
eca-mir-29b-2chr5: 30271159-30271239 [+]
eca-mir-29cchr5: 30271715-30271802 [+]
Database links

Mature sequence eca-miR-29b

Accession MIMAT0012941
Sequence

52 - 

uagcaccauuugaaaucaguguu

 - 74

Get sequence
Deep sequencing1647 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).