Stem-loop sequence eca-mir-214

AccessionMI0012714 (change log)
DescriptionEquus caballus miR-214 stem-loop
Gene family MIPF0000062; mir-214
Literature search

2 open access papers mention eca-mir-214
(17 sentences)

Stem-loop
   u          aca            aacau 
5'  cugccugucu   cuugcugugcag     c
    ||||||||||   ||||||||||||     c
3'  gacggacaga   ggacgacauguc     g
   u          cac            cacuc 
Get sequence
Deep sequencing
2809 reads, 100 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr5: 8098955-8099019 [-]
sense
ENSECAT00000028181 ; eca-mir-214-201; exon 1
antisense
ENSECAT00000029159 ; DNM3-204; intron 14
Clustered miRNAs
< 10kb from eca-mir-214
eca-mir-199achr5: 8104732-8104810 [-]
eca-mir-214chr5: 8098955-8099019 [-]
Database links

Mature sequence eca-miR-214

Accession MIMAT0012963
Sequence

44 - 

acagcaggcacagacaggcagu

 - 65

Get sequence
Deep sequencing2342 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).