Stem-loop sequence eca-mir-197

AccessionMI0012711 (change log)
DescriptionEquus caballus miR-197 stem-loop
Gene family MIPF0000123; mir-197
Literature search

1 open access papers mention eca-mir-197
(3 sentences)

Stem-loop
           c    a       ca    ga   -   a 
5' ggcugugc gggu gagaggg  gugg  ggu aag g
   |||||||| |||| |||||||  ||||  ||| |||  
3' ccgguacg ccca cucuucc  cacu  cca uuc c
           a    c       ac    uc   c   u 
Get sequence
Deep sequencing
316 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr5: 58536553-58536627 [-]
sense
ENSECAT00000028512 ; eca-mir-197-201; exon 1
Database links

Mature sequence eca-miR-197

Accession MIMAT0012959
Sequence

48 - 

uucaccaccuucuccacccagc

 - 69

Get sequence
Deep sequencing315 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).