Stem-loop sequence eca-mir-1905b

AccessionMI0012709 (change log)
DescriptionEquus caballus miR-1905b stem-loop
Gene family MIPF0000753; mir-1905
Stem-loop
          -   a  -c   u a    -u       
5' cugcugc ugg ug  gcu g uggu  gccccc 
   ||||||| ||| ||  ||| | ||||  ||||| u
3' gauggcg auc ac  cga c acca  cggggu 
          c   -  cc   c -    cc       
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr5: 42088659-42088722 [-]
sense
ENSECAT00000028824 ; HCN3-202; intron 11
antisense
ENSECAT00000007269 ; eca-mir-1905b-201; 3'UTR (exon 1)
Database links

Mature sequence eca-miR-1905b

Accession MIMAT0012957
Sequence

43 - 

caccagccccacuacgcgguag

 - 64

Get sequence
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).