Stem-loop sequence eca-mir-16-1

AccessionMI0012707 (change log)
Previous IDseca-mir-16
DescriptionEquus caballus miR-16 stem-loop
Gene family MIPF0000006; mir-15
Literature search

2 open access papers mention eca-mir-16-1
(3 sentences)

Stem-loop
     uc    cu         ua        c  ag   aau 
5' gu  cgcu  agcagcacg  aauauugg gu  uga   a
   ||  ||||  |||||||||  |||||||| ||  |||    
3' cg  gcga  ucgucgugu  uuauaacc ca  auu   a
     gu    uu         ua        a  -a   aua 
Get sequence
Deep sequencing
25171 reads, 1.75e+03 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr5: 15685330-15685410 [+]
sense
ENSECAT00000024113 ; SMC4-201; intron 3
Clustered miRNAs
< 10kb from eca-mir-16-1
eca-mir-15bchr5: 15685189-15685252 [+]
eca-mir-16-1chr5: 15685330-15685410 [+]
Database links

Mature sequence eca-miR-16

Accession MIMAT0012955
Sequence

10 - 

uagcagcacguaaauauuggcg

 - 31

Get sequence
Deep sequencing50285 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).