Stem-loop sequence eca-mir-15b

AccessionMI0012706 (change log)
DescriptionEquus caballus miR-15b stem-loop
Gene family MIPF0000006; mir-15
Literature search

2 open access papers mention eca-mir-15b
(12 sentences)

Stem-loop
      u       c  c      ua   a  ac 
5' cug agcagca au augguu  cau cu  a
   ||| ||||||| || ||||||  ||| ||  g
3' gau ucgucgu ua uacuaa  gua ga  u
      c       u  u      gc   -  ac 
Get sequence
Deep sequencing
587 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr5: 15685189-15685252 [+]
sense
ENSECAT00000028354 ; eca-mir-15b-201; exon 1
ENSECAT00000024113 ; SMC4-201; intron 3
Clustered miRNAs
< 10kb from eca-mir-15b
eca-mir-15bchr5: 15685189-15685252 [+]
eca-mir-16-1chr5: 15685330-15685410 [+]
Database links

Mature sequence eca-miR-15b

Accession MIMAT0012954
Sequence

4 - 

uagcagcacaucaugguuuaca

 - 25

Get sequence
Deep sequencing539 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).