Stem-loop sequence eca-mir-137

AccessionMI0012705 (change log)
DescriptionEquus caballus miR-137 stem-loop
Gene family MIPF0000106; mir-137
Stem-loop
         ug   g           ug a     -  g 
5' cuucgg  acg guauucuuggg  g uaaua cg a
   ||||||  ||| |||||||||||  | ||||| || u
3' ggagcu  ugc cauaagaauuc  u auugu gc u
         ga   g           gu -     u  a 
Get sequence
Deep sequencing
1 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr5: 67623778-67623850 [+]
sense
ENSECAT00000027790 ; eca-mir-137-201; exon 1
Database links

Mature sequence eca-miR-137

Accession MIMAT0012953
Sequence

45 - 

uuauugcuuaagaauacgcguag

 - 67

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).