Stem-loop sequence eca-mir-135b

AccessionMI0012704 (change log)
DescriptionEquus caballus miR-135b stem-loop
Gene family MIPF0000028; mir-135
Literature search

3 open access papers mention eca-mir-135b
(21 sentences)

Stem-loop
        --                   cau          uugcug 
5' gcucu  gcuguggccuauggcuuuu   uccuauguga      u
   |||||  |||||||||||||||||||   ||||||||||       
3' cgggg  ugacaucggguaccgaaaa   gggauguacu      u
        ag                   -uc          caaauc 
Get sequence
Deep sequencing
284 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr5: 1903337-1903425 [-]
intergenic
Database links

Mature sequence eca-miR-135b

Accession MIMAT0012952
Sequence

15 - 

uauggcuuuucauuccuauguga

 - 37

Get sequence
Deep sequencing274 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).