Stem-loop sequence eca-mir-101-1

AccessionMI0012703 (change log)
Previous IDseca-mir-101
DescriptionEquus caballus miR-101 stem-loop
Gene family MIPF0000046; mir-101
Literature search

1 open access papers mention eca-mir-101-1
(2 sentences)

Stem-loop
   c                  a    gucag 
5'  ucaguuaucacagugcug ugcu     u
    |||||||||||||||||| ||||      
3'  agucaauagugucaugac augg     u
   a                  -    aaauc 
Get sequence
Deep sequencing
6301 reads, 350 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr5: 95527930-95527988 [+]
intergenic
Database links

Mature sequence eca-miR-101

Accession MIMAT0012951
Sequence

39 - 

uacaguacugugauaacugaa

 - 59

Get sequence
Deep sequencing19958 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).