Stem-loop sequence eca-mir-671

AccessionMI0012701 (change log)
DescriptionEquus caballus miR-671 stem-loop
Gene family MIPF0000358; mir-671
Stem-loop
       a        a   a      ga           -u   g 
5' ggcc ggaagagg gga gcccug  ggggcuggagg  gau g
   |||| |||||||| ||| ||||||  |||||||||||  |||  
3' ccgg ccuucucc ccu cgggac  ucuuggccucc  uug a
       g        a   -      --           uu   u 
Get sequence
Deep sequencing
175 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr4: 102828539-102828622 [+]
sense
ENSECAT00000016706 ; eca-mir-671-201; 3'UTR (exon 4)
Database links

Mature sequence eca-miR-671-5p

Accession MIMAT0012948
Sequence

14 - 

aggaagcccuggaggggcuggag

 - 36

Get sequence
Deep sequencing29 reads, 1 experiments
Evidence not experimental

Mature sequence eca-miR-671-3p

Accession MIMAT0012949
Sequence

53 - 

uccgguucucagggcuccacc

 - 73

Get sequence
Deep sequencing146 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).