Stem-loop sequence eca-mir-489

AccessionMI0012697 (change log)
DescriptionEquus caballus miR-489 stem-loop
Gene family MIPF0000111; mir-489
Literature search

1 open access papers mention eca-mir-489
(2 sentences)

Stem-loop
          c     g            gc c     -auuu a 
5' guggcag uuggu gucguaugugug  g cauuu     g c
   ||||||| ||||| ||||||||||||  | |||||     |  
3' caucguc aaucg cggcauauacac  c gugag     c c
          a     g            ua a     gauuu c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr4: 37128192-37128276 [-]
sense
ENSECAT00000003360 ; CALCR-201; intron 1
Clustered miRNAs
< 10kb from eca-mir-489
eca-mir-489chr4: 37128192-37128276 [-]
eca-mir-653chr4: 37127476-37127560 [-]
Database links

Mature sequence eca-miR-489

Accession MIMAT0012943
Sequence

53 - 

gugacaucacauauacggcggc

 - 74

Get sequence
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).