Stem-loop sequence eca-mir-29b

AccessionMI0012695 (change log)
DescriptionEquus caballus miR-29b stem-loop
Gene family MIPF0000009; mir-29
Literature search

2 open access papers mention eca-mir-29b
(9 sentences)

Stem-loop
   -         -          u      gu      uuaaa 
5'  cuucaggaa gcugguuuca auggug  uuagau     u
    ||||||||| |||||||||| ||||||  ||||||     a
3'  gggguucuu ugacuaaagu uaccac  gaucug     g
   g         g          u      --      uuagu 
Get sequence
Deep sequencing
833 reads, 50 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr4: 85327107-85327187 [-]
intergenic
Clustered miRNAs
< 10kb from eca-mir-29b
eca-mir-29bchr4: 85327107-85327187 [-]
eca-mir-29achr4: 85326728-85326792 [-]
Database links

Mature sequence eca-miR-29b

Accession MIMAT0012941
Sequence

51 - 

uagcaccauuugaaaucaguguu

 - 73

Get sequence
Deep sequencing1647 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).