Stem-loop sequence eca-mir-29a

Accession MI0012694
Description Equus caballus miR-29a stem-loop
Gene family MIPF0000009; mir-29
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-29_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-29 microRNA precursor, or pre-miRNA, is a small RNA molecule in the shape of a stem-loop or hairpin. Each arm of the hairpin can be processed into one member of a closely related family of short non-coding RNAs that are involved in regulating gene expression. The processed, or "mature" products of the precursor molecule are known as microRNA (miRNA), and have been predicted or confirmed in a wide range of species (see 'MIPF0000009' in miRBase: the microRNA database).

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
g            uuu       c    ucaa 
 augacugauuuc   ugguguu agag    u
 ||||||||||||   ||||||| ||||    a
 uauuggcuaaag   accacga ucuu    u
-            ucu       -    uuaa 
Get sequence
Genome context
Coordinates (EquCab2) Overlapping transcripts
4: 85326728-85326792 [-]
intergenic
Clustered miRNAs
< 10kb from eca-mir-29a
eca-mir-29b 4: 85327107-85327187 [-]
eca-mir-29a 4: 85326728-85326792 [-]
Database links

Mature sequence eca-miR-29a

Accession MIMAT0012940
Sequence

43 - 

uagcaccaucugaaaucgguua

 - 64

Get sequence
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).