Stem-loop sequence eca-mir-29a

AccessionMI0012694 (change log)
DescriptionEquus caballus miR-29a stem-loop
Gene family MIPF0000009; mir-29
Literature search

3 open access papers mention eca-mir-29a
(5 sentences)

Stem-loop
   g            uuu       c    ucaa 
5'  augacugauuuc   ugguguu agag    u
    ||||||||||||   ||||||| ||||    a
3'  uauuggcuaaag   accacga ucuu    u
   -            ucu       -    uuaa 
Get sequence
Deep sequencing
3588 reads, 150 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr4: 85326728-85326792 [-]
intergenic
Clustered miRNAs
< 10kb from eca-mir-29a
eca-mir-29bchr4: 85327107-85327187 [-]
eca-mir-29achr4: 85326728-85326792 [-]
Database links

Mature sequence eca-miR-29a

Accession MIMAT0012940
Sequence

43 - 

uagcaccaucugaaaucgguua

 - 64

Get sequence
Deep sequencing3578 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).