Stem-loop sequence eca-mir-196b

AccessionMI0012693 (change log)
DescriptionEquus caballus miR-196b stem-loop
Gene family MIPF0000031; mir-196
Literature search

1 open access papers mention eca-mir-196b
(1 sentences)

Stem-loop
   --     uc      uu       u  c           ucca 
5'   acugg  ggugau  agguagu uc uguuguuggga    g
     |||||  ||||||  ||||||| || |||||||||||     
3'   ugacu  ucauua  uccguca ag acgacagcucu    c
   gu     --      cu       c  c           cuuu 
Get sequence
Deep sequencing
19 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr4: 58199179-58199262 [-]
intergenic
Database links

Mature sequence eca-miR-196b

Accession MIMAT0012939
Sequence

15 - 

uagguaguuuccuguuguuggg

 - 36

Get sequence
Deep sequencing19 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).