Stem-loop sequence eca-mir-148a

AccessionMI0012689 (change log)
DescriptionEquus caballus miR-148a stem-loop
Gene family MIPF0000056; mir-148
Literature search

2 open access papers mention eca-mir-148a
(2 sentences)

Stem-loop
                 -  -a    cc    -   aa 
5' gaggcaaaguucug ag  cacu  gacu cug  u
   |||||||||||||| ||  ||||  |||| |||  a
3' cucuguuucaagac uc  guga  cuga gau  u
                 a  ac    --    a   ag 
Get sequence
Deep sequencing
87560 reads, 6.35e+03 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr4: 57171932-57171999 [-]
intergenic
Database links

Mature sequence eca-miR-148a

Accession MIMAT0012935
Sequence

44 - 

ucagugcacuacagaacuuugu

 - 65

Get sequence
Deep sequencing86574 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).