Stem-loop sequence eca-mir-95

AccessionMI0012686 (change log)
DescriptionEquus caballus miR-95 stem-loop
Gene family MIPF0000098; mir-95
Stem-loop
   a   c     gc          ug           gaga 
5'  aca agugg  gcucaauaaa  uuuguugaauu    u
    ||| |||||  ||||||||||  |||||||||||    g
3'  ugu ucacc  cgaguuauuu  gggcaacuuaa    c
   g   c     aa          cu           auug 
Get sequence
Deep sequencing
423 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr3: 115690378-115690458 [-]
sense
ENSECAT00000017823 ; ABLIM2-203; intron 14
ENSECAT00000017816 ; ABLIM2-202; intron 15
ENSECAT00000017786 ; ABLIM2-201; intron 16
Database links

Mature sequence eca-miR-95

Accession MIMAT0012931
Sequence

49 - 

uucaacgggucuuuauugagca

 - 70

Get sequence
Deep sequencing412 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).