Stem-loop sequence eca-mir-328

AccessionMI0012684 (change log)
DescriptionEquus caballus miR-328 stem-loop
Gene family MIPF0000203; mir-328
Literature search

1 open access papers mention eca-mir-328
(3 sentences)

Stem-loop
     ag           ga     u     a aaa  g 
5' gg  cgggggggcag  ggggc caggg g   gu u
   ||  |||||||||||  ||||| ||||| |   ||  
3' cc  gccuucccguc  ucccg guccc c   cg g
     cu           uc     -     - -ga  u 
Get sequence
Deep sequencing
215 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr3: 17669430-17669500 [-]
antisense
ENSECAT00000007622 ; ELMO3-201; intron 15
Database links

Mature sequence eca-miR-328

Accession MIMAT0012929
Sequence

47 - 

cuggcccucucugcccuuccgu

 - 68

Get sequence
Deep sequencing215 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).