Stem-loop sequence eca-mir-140

AccessionMI0012682 (change log)
DescriptionEquus caballus miR-140 stem-loop
Gene family MIPF0000085; mir-140
Literature search

7 open access papers mention eca-mir-140
(12 sentences)

Stem-loop
   cca             a       uu   uc 
5'    gugguuuuacccu ugguagg  acg  a
      ||||||||||||| |||||||  |||   
3'    caccaagauggga accaucu  ugu  u
   -gg             c       --   cg 
Get sequence
Deep sequencing
374 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr3: 19908675-19908735 [+]
sense
ENSECAT00000028381 ; eca-mir-140-201; exon 1
ENSECAT00000007141 ; WWP2-201; intron 15
Database links

Mature sequence eca-miR-140-5p

Accession MIMAT0012926
Sequence

2 - 

cagugguuuuacccuaugguag

 - 23

Get sequence
Deep sequencing152 reads, 1 experiments
Evidence not experimental

Mature sequence eca-miR-140-3p

Accession MIMAT0012927
Sequence

41 - 

uaccacaggguagaaccacgg

 - 61

Get sequence
Deep sequencing221 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).