Stem-loop sequence eca-mir-761

AccessionMI0012679 (change log)
DescriptionEquus caballus miR-761 stem-loop
Gene family MIPF0000709; mir-761
Stem-loop
   --                       g  a  g 
5'   aggaggagcagcagggugaaacu ac ca u
     ||||||||||||||||||||||| || ||  
3'   uccuccucgucguuucacuuuga ug gu u
   ag                       g  -  c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr2: 7430923-7430985 [+]
sense
ENSECAT00000027868 ; eca-mir-761-201; exon 1
ENSECAT00000023926 ; NRD1-201; 3'UTR (exon 4)
Database links

Mature sequence eca-miR-761

Accession MIMAT0012923
Sequence

8 - 

gcagcagggugaaacugacaca

 - 29

Get sequence
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).