Stem-loop sequence eca-mir-429

AccessionMI0012675 (change log)
DescriptionEquus caballus miR-429 stem-loop
Gene family MIPF0000019; mir-8
Literature search

2 open access papers mention eca-mir-429
(2 sentences)

Stem-loop
   --     u -          cg       cugcg 
5'   gggcg c uuaccagaca  guuagau     u
     ||||| | ||||||||||  |||||||      
3'   ccugc g aauggucugu  uaaucug     c
   ua     c u          ca       ucuuc 
Get sequence
Deep sequencing
7 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr2: 48453025-48453091 [-]
intergenic
Clustered miRNAs
< 10kb from eca-mir-429
eca-mir-200bchr2: 48455071-48455139 [-]
eca-mir-200achr2: 48454404-48454493 [-]
eca-mir-3548chr2: 48454387-48454515 [+]
eca-mir-429chr2: 48453025-48453091 [-]
Database links

Mature sequence eca-miR-429

Accession MIMAT0012919
Sequence

42 - 

uaauacugucugguaaugccg

 - 62

Get sequence
Deep sequencing7 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).