Stem-loop sequence eca-mir-34a

AccessionMI0012673 (change log)
Previous IDseca-mir-34
DescriptionEquus caballus miR-34 stem-loop
Gene family MIPF0000039; mir-34
Literature search

1 open access papers mention eca-mir-34a
(3 sentences)

Stem-loop
   u        -   a          guga   a 
5'  ggcagugu cuu gcugguuguu    gua u
    |||||||| ||| ||||||||||    |||  
3'  ccgucaua gaa cgacuaacga    cgu a
   -        u   -          aggg   g 
Get sequence
Deep sequencing
52 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr2: 41934533-41934595 [+]
intergenic
Database links

Mature sequence eca-miR-34a

Accession MIMAT0012917
Previous IDseca-miR-34
Sequence

1 - 

uggcagugucuuagcugguugu

 - 22

Get sequence
Deep sequencing52 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).