Stem-loop sequence eca-mir-30e

AccessionMI0012672 (change log)
DescriptionEquus caballus miR-30e stem-loop
Gene family MIPF0000005; mir-30
Literature search

4 open access papers mention eca-mir-30e
(11 sentences)

Stem-loop
   g        uu  ua            uu           g aag u 
5'  ggcagucu  gc  cuguaaacaucc  gacuggaagcu u   g g
    ||||||||  ||  ||||||||||||  ||||||||||| |   |  
3'  ccgucgga  cg  gacauuuguagg  cugacuuucga g   c u
   a        --  gc            --           g aga u 
Get sequence
Deep sequencing
28519 reads, 1.8e+03 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr2: 17435650-17435741 [-]
sense
ENSECAT00000002155 ; NFYC-201; intron 5
Clustered miRNAs
< 10kb from eca-mir-30e
eca-mir-30echr2: 17435650-17435741 [-]
eca-mir-30cchr2: 17432728-17432816 [-]
Database links

Mature sequence eca-miR-30e

Accession MIMAT0012916
Sequence

17 - 

uguaaacauccuugacuggaag

 - 38

Get sequence
Deep sequencing25995 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).