Stem-loop sequence eca-mir-302d

AccessionMI0012670 (change log)
DescriptionEquus caballus miR-302d stem-loop
Gene family MIPF0000071; mir-302
Literature search

2 open access papers mention eca-mir-302d
(2 sentences)

Stem-loop
     u u   uu                cugugac 
5' cc c acu  aacauggaggcacuug       u
   || | |||  ||||||||||||||||       u
3' gg g uga  uuguaccuucgugaau       g
     u -   uu                aaaaaga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr2: 113629533-113629600 [+]
antisense
ENSECAT00000001702 ; LARP7-201; intron 8
ENSECAT00000001915 ; LARP7-202; intron 8
Clustered miRNAs
< 10kb from eca-mir-302d
eca-mir-302bchr2: 113629063-113629138 [+]
eca-mir-302cchr2: 113629201-113629268 [+]
eca-mir-302achr2: 113629373-113629440 [+]
eca-mir-302dchr2: 113629533-113629600 [+]
eca-mir-367chr2: 113629662-113629729 [+]
Database links

Mature sequence eca-miR-302d

Accession MIMAT0012914
Sequence

44 - 

uaagugcuuccauguuuuagugu

 - 66

Get sequence
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).