Stem-loop sequence eca-mir-302c

AccessionMI0012669 (change log)
DescriptionEquus caballus miR-302c stem-loop
Gene family MIPF0000071; mir-302
Literature search

2 open access papers mention eca-mir-302c
(2 sentences)

Stem-loop
       ug  uu             c    -g  u 
5' ccuu  cu  aacauggggguac ugcu  ug a
   ||||  ||  ||||||||||||| ||||  || a
3' ggag  ga  uuguaccuucgug auga  ac a
       gu  cu             a    aa  g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr2: 113629201-113629268 [+]
antisense
ENSECAT00000001702 ; LARP7-201; intron 8
ENSECAT00000001915 ; LARP7-202; intron 8
Clustered miRNAs
< 10kb from eca-mir-302c
eca-mir-302bchr2: 113629063-113629138 [+]
eca-mir-302cchr2: 113629201-113629268 [+]
eca-mir-302achr2: 113629373-113629440 [+]
eca-mir-302dchr2: 113629533-113629600 [+]
eca-mir-367chr2: 113629662-113629729 [+]
Database links

Mature sequence eca-miR-302c

Accession MIMAT0012913
Sequence

43 - 

uaagugcuuccauguuucagugg

 - 65

Get sequence
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).