Stem-loop sequence eca-mir-302b

AccessionMI0012668 (change log)
DescriptionEquus caballus miR-302b stem-loop
Gene family MIPF0000071; mir-302
Literature search

2 open access papers mention eca-mir-302b
(2 sentences)

Stem-loop
   acucu    a   uu        c ug   u    gacu 
5'      cuuu acu  aacaugga g  cuu cugu    u
        |||| |||  |||||||| |  ||| ||||     
3'      gaag uga  uuguaccu c  gaa gaua    g
   ----u    a   uu        u gu   u    aaac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr2: 113629063-113629138 [+]
antisense
ENSECAT00000001702 ; LARP7-201; intron 8
ENSECAT00000001915 ; LARP7-202; intron 8
Clustered miRNAs
< 10kb from eca-mir-302b
eca-mir-302bchr2: 113629063-113629138 [+]
eca-mir-302cchr2: 113629201-113629268 [+]
eca-mir-302achr2: 113629373-113629440 [+]
eca-mir-302dchr2: 113629533-113629600 [+]
eca-mir-367chr2: 113629662-113629729 [+]
Database links

Mature sequence eca-miR-302b

Accession MIMAT0012912
Sequence

50 - 

uaagugcuuccauguuuuaguag

 - 72

Get sequence
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).